Register
Client Area

iWriteGigs

support@iwritegigs.com
Facebook-f
Register
Client Area

Fresh Grad Lands Job as Real Estate Agent With Help from Professional Writers

People go to websites to get the information they desperately need.  They could be looking for an answer to a nagging question.  They might be looking for help in completing an important task.  For recent graduates, they might be looking for ways on how to prepare a comprehensive resume that can capture the attention of the hiring manager

Manush is a recent graduate from a prestigious university in California who is looking for a job opportunity as a real estate agent.  While he already has samples provided by his friends, he still feels something lacking in his resume.  Specifically, the he believes that his professional objective statement lacks focus and clarity. 

Thus, he sought our assistance in improving editing and proofreading his resume. 

In revising his resume, iwritegigs highlighted his soft skills such as his communication skills, ability to negotiate, patience and tactfulness.  In the professional experience part, our team added some skills that are aligned with the position he is applying for.

When he was chosen for the real estate agent position, he sent us this thank you note:

“Kudos to the team for a job well done.  I am sincerely appreciative of the time and effort you gave on my resume.  You did not only help me land the job I had always been dreaming of but you also made me realize how important adding those specific keywords to my resume!  Cheers!

Manush’s story shows the importance of using powerful keywords to his resume in landing the job he wanted.

Module 4 Exam

Navigation   » List of Schools  »  Irvine Valley College  »  Biology  »  Biology 1 – The Life Sciences  »  2019  »  Module 4 Exam

Need help with your exam preparation?


Existing Quiz Clients Login here

Below are the questions for the exam with the choices of answers:

Question #1
What is the main function of DNA?,,
A  to produce ATP
B  to provide structural support to the cell
C  to encode proteins
D  to speed up cell reactions
Question #2
Cancer is believed to be associated with a failure of the cell cycle.
A  FALSE
B  TRUE
Question #3
The chemotherapy drug taxol inhibits microtubule function. A cell treated with taxol would become stuck in which phase?  
A  telophase
B  prophase
C  telophase
D  anaphase
Question #4
During cytokinesis of a plant cell, the cell divides by forming a cleavage furrow.
A  FALSE
B  TRUE
Question #5
In some fungi and slime molds, mitosis may occur without cytokinesis. What would you expect to find in these species?
A  DNA that never condenses into visible chromosomes
B  cells that don’t contain nuclei
C  nuclei that never enter interphase
D  cells that contain multiple nuclei
Question #6
Which phase of mitosis involves the forming of the nuclear membrane?
A  Metaphase
B  Prophase
C  Telophase
D  Anaphase
Question #7
Which phase of mitosis occurs second in the change of events?
A  Anaphase
B  Telophase
C  Prophase
D  Metaphase
Question #8
When, during mitosis, do we first see the functioning centrosomes?
A  Prophase
B  Telophase
C  Metaphase
D  Anaphase
Question #9
When a cell first enters into cell division, the DNA in its nucleus
A  condenses to form thick, ribbonlike chromosomes
B  is copied
C  unravels to form chromatin
D  completely disintegrates
Question #10
Which phase of the cell cycle directly precedes mitosis?
A  Cytokinesis
B  G1 phase
C  S phase
D  G2 phase
Question #11
In mitosis of animal cells, cytokinesis involves the
A  the formation of a cleavage furrow
B  the splitting of nucleus
C  the formation of a cell plate
D  formation of the membranes
Question #12
The majority of a cell’s life cycle is spent in
A  Interphase
B  Mitosis
C  G2 phase
D  Cytokinesis
Question #13
Bacteria go through a form of cell division called _____________.
A  binary fission
B  Cytokinesis
C  binary fusion
D  None of the above
Question #14
DNA is packaged in units called
A  chromosomes
B  centromeres
C  histones
D  centrosomes
Question #15
Many viruses are inhibited by antibiotics
A  FALSE
B  TRUE
Question #16
All mutations are harmful
A  TRUE
B  FALSE
Question #17
All mutations involve some kind of change in the genetic code.
A  FALSE
B  TRUE
Question #18
How many codons are in the mRNA sequence GGAAUGAAACAGGAACCCAAA?  
A  7
B  4
C  18
D  10
Question #19
In a “nonsense” mutation  
A  the codon that mutates causes a stop codon to occur instead of the placement of an amino acid. 
B  the codon that mutates causes a change in the amino acid specified. 
C  the codon that mutates does not cause a change in the amino acid specified. 
D  the mutation is not in DNA.
Question #20
What amino acid code does ACU code for?
A  Leucine
B  both Serine and Proline
C  Threonine
D  Arginine
E  Serine
F  Proline
Question #21
A group of genes, a promoter, and an operator that control transcription are called a(n
A  ribosome.
B  operon.
C  translational unit.
D  chromosome. 
E  envelope. 
Question #22
The step of translation in which the first amino acids joins the ribosome and mRNA is  
A  initiation
B  elongation
C  termination
D  mitosis
Question #23
Your entire genetic code is analogous to ________________.
A  an electric motor
B  a cook
C  a recipe
D  a cookbook
Question #24
What is the anticodon for GUU?
A  CAA
B  UAG
C  TAG
D  None of the above
Question #25
In eukaryotic cells, sequences of mRNA that are NOT removed before translation are called  
A  anticodons
B  exons
C  introns
D  terminators
Question #26
Proteins are made up of ______ different kinds of amino acid.
A  20
B  46
C  50
D  4
Question #27
rRNA carries the instructions for translation.
A  TRUE
B  FALSE
Question #28
 If the DNA template strand has the following sequence, what would be the nucleotide sequence of the complementary RNA molecule produced in transcription? Template strand: GACCTTA
A   UCAGAA
B  CUGGAAU
C   TCAGAA
D   AGTCTT
Question #29
RNA differs from DNA in many ways, including
A  DNA is double stranded and RNA is single stranded. 
B  DNA contains deoxyribose and RNA contains ribose
C  DNA contains thymine and RNA contains uracil instead of thymine
D  RNA can catalyze some chemical reactions and DNA cannot.
E  All of the above are correct
Question #30
In Translation, what brings in new amino acids?
A  RNA polymerase
B  the ribosome
C  the amino acids
D  the transfer RNA
Question #31
In Transcription, DNA is copied to produce
A  a ribosome
B  RNA polymerase
C  transfer RNA
D  messenger RNA
Question #32
RNA is composed of building blocks called
A  disaccharides
B  amino acids
C  phospholipids
D  nucleotides
E  monosaccharides
Play Video

“Many thanks for the killer business plan we worked on.  You guys are angels sent to me.  Congratulations to the team for a job well done. I hope you help more entrepreneurs like me grow their businesses.  I will surely bring some clients your way!”

Christian S.
SaaS Business Founder

“Thanks for all your help in bringing my website back to life. You are life savers.  With your help, I now have a more thorough understanding of my target audience.  I wish I had met your earlier, I could have saved tons of work hours.”

Tyra
Blogger

“We can never be thankful enough iwritegigs.com for helping us with our business.  We have been hesitating for years hiring a professional writer thinking it was only an extra cost to our business.  It has been a pleasure working with you.” 

Linda
Start Up Founder

“Kudos to the team for a job well done.  I am sincerely appreciative of the time and effort you gave on my resume.  You did not only help me land the job I had always been dreaming of but you also made me realize how important adding those specific keywords to my resume!  Cheers!

Manush
Fresh Graduate
We accept payment

Terms of Service
Copyright © 2021 iWriteGigs
ElitePro Writing Business Solutions LLC

30 N Gould St Ste R, Sheridan, WY 82801 

Call Us at 1-(323) 410-1787
Send us sms at 1-(323) 410-1787

17 Mabini St. Barangay San Diego Zone 2 Tayabas City, Philippines